Display Settings:

Format

Send to:

Choose Destination
Pr012821517

Homo sapiens STS probe D5S407

Synopsis

Field NameValues
NameD5S407
Aliases163XA11; AFM163xa11; HS163XA11; RH15129; RH9469
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:74384

Sequences

>Probe|12821517|PRIMERF Forward PCR primer (outermost) (20b)
TGGTTTAGAGAATTTGCCCC
>Probe|12821517|PRIMERR Reverse PCR primer (outermost) (25b)
CTGTGATTTGTTGTTCATTGGAAGT

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageMarshfield564.67 cmAFM163xa11
Homo sapienslinkageGenethon565 cmAFM163xa11

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:188127
UniSTS IDcontext specific help for: UniSTS ID74384
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk