Display Settings:

Format

Send to:

Choose Destination
Pr012821443

STS probe SHGC-35280 for arachidonate 15-lipoxygenase (ALOX15) and 3 more genes

Synopsis

Field NameValues
NameSHGC-35280
AliasesRH33570; RH55077; SGC35280; STS_M23892
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100288795; LOC100598410; ALOX15; ALOX15
UniSTS IDUniSTS:74314

Sequences

>Probe|12821443|PRIMERF Forward PCR primer (outermost) (19b)
TGGTTATAGCCCTGCCCTC
>Probe|12821443|PRIMERR Reverse PCR primer (outermost) (24b)
GTGGCTATTTGCCATATAGATCTG

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Show All 4 References...

3.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

4.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G317284 cr10000SHGC-35280
Homo sapiensradiation hybridGeneMap99-GB41743.27 cr3000SGC35280
Homo sapienslinkageRutgers Map17 cmSHGC-35280
Homo sapiensradiation hybridNCBI RH1762 crSGC35280
Homo sapiensradiation hybridWhitehead-RH1755 cr3000SGC35280

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID74314
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk