Display Settings:

Format

Send to:

Choose Destination
Pr012820797

STS probe D6S1921 for aryl hydrocarbon receptor-like (LOC100428092) and 2 more genes

Synopsis

Field NameValues
NameD6S1921
AliasesHALD59E7; MR5670; WI-3878
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100428092; LOC100451072; LOC100582703
UniSTS IDUniSTS:7373

Sequences

>Probe|12820797|PRIMERF Forward PCR primer (outermost) (25b)
ACACAATTTTGTTCTCCTTAGTTGG
>Probe|12820797|PRIMERR Reverse PCR primer (outermost) (23b)
ATGTACAGACCACATTTGGATCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmD6S1921

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID7373
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678627
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk