Display Settings:

Format

Send to:

Choose Destination
Pr012820406

STS probe D15S1202 for ribosomal protein, large, P1 (RPLP1) and 3 more genes

Synopsis

Field NameValues
NameD15S1202
AliasesRH3899; RH54095; RP_P1; WI-9701
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCOPS4; RPLP1; LOC100662606; RPLP1
UniSTS IDUniSTS:73374

Sequences

>Probe|12820406|PRIMERF Forward PCR primer (outermost) (18b)
TGGCCAACGTCAACATTG
>Probe|12820406|PRIMERR Reverse PCR primer (outermost) (20b)
GTCATCATCAGACTCCTCGG

References

1.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridWhitehead-RH15233.5 cr3000WI-9701

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678400
UniSTS IDcontext specific help for: UniSTS ID73374
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk