Display Settings:

Format

Send to:

Choose Destination
Pr012819846

STS probe SHGC-12862 for cyclin-dependent kinase 7 (CDK7) and 2 more genes

Synopsis

Field NameValues
NameSHGC-12862
AliasesCDK7; RH14087; UTR-04815; WI-7856
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCDK7; CDK7; CDK7
UniSTS IDUniSTS:72869

Sequences

>Probe|12819846|PRIMERF Forward PCR primer (outermost) (24b)
TGGACAACATTTTACTACTGAGGG
>Probe|12819846|PRIMERR Reverse PCR primer (outermost) (24b)
TAAGTTTTCCCTAATGCATTTTCA

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G352500 cr10000SHGC-12862
Homo sapienslinkageRutgers Map5 cmSHGC-12862

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID72869
Probe Cross-refcontext specific help for: Probe Cross-refGDB:677708
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk