Display Settings:

Format

Send to:

Choose Destination
Pr012819624

STS probe D20S823 for retinoblastoma-like 1 (RBL1) and 2 more genes

Synopsis

Field NameValues
NameD20S823
AliasesRH31969; SHGC-2784
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesRBL1; RBL1; RBL1
UniSTS IDUniSTS:72666

Sequences

>Probe|12819624|PRIMERF Forward PCR primer (outermost) (25b)
TGCTTTGTATCACAACATTGCATTC
>Probe|12819624|PRIMERR Reverse PCR primer (outermost) (24b)
TCCTGATTCGCCAAGTCGTATTTC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3201944 cr10000SHGC-2784
Homo sapienslinkageRutgers Map20 cmD20S823
Homo sapiensradiation hybridNCBI RH20321.2 crSHGC-2784

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID72666
Probe Cross-refcontext specific help for: Probe Cross-refGDB:598483
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk