Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012819525

Homo sapiens STS probe SHGC-14031 for uncharacterized LOC100508892 (LOC100508892) and 1 more gene

Synopsis

Field NameValues
NameSHGC-14031
AliasesRH29605; RH95597
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100508892 (Homo sapiens); LOC100510460 (Homo sapiens)

Sequences

>Probe|12819525|PRIMERF Forward PCR primer (outermost) (23b)
TGCTTCAGATGTCTTGTATTCCA
>Probe|12819525|PRIMERR Reverse PCR primer (outermost) (21b)
GCTCTTGGCCTAGGTAATTGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G315553 cr10000SHGC-14031
Homo sapiensradiation hybridTNG157639 cr50000SHGC-14031
Homo sapienslinkageRutgers Map15 cmSHGC-14031
Homo sapiensradiation hybridNCBI RH1571.8 crSHGC-14031

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID72575
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk