Display Settings:

Format

Send to:

Choose Destination
Pr012818558

STS probe D17S634 for WD repeat containing antisense to TP53 (WRAP53) and 2 more genes

Synopsis

Field NameValues
NameD17S634
AliasHUMUT171
TypeSTS
Application
Source organism
Source sequence
Target genesHADHB; WRAP53; WRAP53
UniSTS IDUniSTS:71700

Sequences

>Probe|12818558|PRIMERF Forward PCR primer (outermost) (23b)
TGCATTCCAGCCTGGGCGACAGA
>Probe|12818558|PRIMERR Reverse PCR primer (outermost) (25b)
CTGGGAATATAAGCATAAGCCACCA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:185970
UniSTS IDcontext specific help for: UniSTS ID71700
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk