Display Settings:

Format

Send to:

Choose Destination
Pr012818512

STS probe D12S1897 for lysine demethylase 5A (KDM5A) and 3 more genes

Synopsis

Field NameValues
NameD12S1897
AliasesD12S1914; RH8739; SHGC-9936
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100434191; KDM5A; KDM5A; KDM5A
UniSTS IDUniSTS:71658

Sequences

>Probe|12818512|PRIMERF Forward PCR primer (outermost) (20b)
TGCATGGACTCTGTGGGTTA
>Probe|12818512|PRIMERR Reverse PCR primer (outermost) (22b)
AGAGCTCAATTAAGCATCTGGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G31227 cr10000SHGC-9936
Homo sapiensradiation hybridGeneMap99-G31227 cr10000SHGC-9936
Homo sapienslinkageRutgers Map12 cmD12S1897
Homo sapiensradiation hybridNCBI RH1211.8 crSHGC-9936

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID71658
Probe Cross-refcontext specific help for: Probe Cross-refGDB:675059; GDB:675639
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk