Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012818228

Pan troglodytes and Homo sapiens STS probe D7S688 for enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) and 1 more gene

Synopsis

Field NameValues
NameD7S688
Aliases324ZF9; AFM324zf9; HS324ZF9; RH42574; sWSS1128
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Homo sapiens
Target genesEZH2 (Homo sapiens); EZH2 (Pan troglodytes)

Sequences

>Probe|12818228|PRIMERF Forward PCR primer (outermost) (25b)
TGCAGAAATGCCTCCCTAAATATAA
>Probe|12818228|PRIMERR Reverse PCR primer (outermost) (22b)
ACAGGAAACGATTGCCATCCTT

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageMarshfield7159.53 cmAFM324zf9
Homo sapienslinkageGenethon7162.3 cmAFM324zf9

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:199984
UniSTS IDcontext specific help for: UniSTS ID71399
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk