Display Settings:

Format

Send to:

Choose Destination
Pr012817990

STS probe AL008944 for zinc finger and BTB domain containing 33 (ZBTB33) and 8 more genes

Synopsis

Field NameValues
NameAL008944
AliasesDJ454M14SP6; STSG36134
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesZBTB33; ZBTB33; ZBTB33; LOC100413015; LOC100424019; ZBTB33; ZBTB33; ZBTB33; ZBTB33
UniSTS IDUniSTS:71182

Sequences

>Probe|12817990|PRIMERF Forward PCR primer (outermost) (22b)
TGCAAGGTTTATGCAAATATCG
>Probe|12817990|PRIMERR Reverse PCR primer (outermost) (21b)
ATACGTTTGTTTGCCATCTCG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL008944

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID71182
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk