Display Settings:

Format

Send to:

Choose Destination
Pr012817195

STS probe D11S4339 for CD59 molecule, complement regulatory protein (CD59) and 2 more genes

Synopsis

Field NameValues
NameD11S4339
AliasesRH2092; SHGC-9865
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCD59; CD59; CD59
UniSTS IDUniSTS:70461

Sequences

>Probe|12817195|PRIMERF Forward PCR primer (outermost) (21b)
TGAGGAAGTACTGACCATGCC
>Probe|12817195|PRIMERR Reverse PCR primer (outermost) (25b)
ATTCATCAAAATTGTTTCTCATTCC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3111600 cr10000SHGC-9865
Homo sapiensradiation hybridGeneMap99-G3111600 cr10000SHGC-9865
Homo sapienslinkageRutgers Map11 cmD11S4339

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID70461
Probe Cross-refcontext specific help for: Probe Cross-refGDB:675011; GDB:675623
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk