Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012816938

Eukaryota (4 taxa) STS probe HUM00D0F11 for proteasome (prosome, macropain) subunit, beta type, 5 (PSMB5) and 4 more genes

Synopsis

Field NameValues
NameHUM00D0F11
AliasesHUM0C13F10; RH1345; RH1361; SHGC-2470; SHGC-2576
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Pongo abelii; Homo sapiens
Target genesPSMB5 (Pongo abelii); LOC100408750 (Callithrix jacchus); LOC100457600 (Pongo abelii); PSMB5 (Nomascus leucogenys); PSMB5 (Homo sapiens)

Sequences

>Probe|12816938|PRIMERF Forward PCR primer (outermost) (23b)
TGAGAAGTATAGTGGCTCTACCC
>Probe|12816938|PRIMERR Reverse PCR primer (outermost) (26b)
GAAAGTAAAACAAATAGTCACCTCTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G314262 cr10000SHGC-2576
Homo sapiensradiation hybridStanford-G314274 cr10000SHGC-2470
Homo sapiensradiation hybridGeneMap99-G314262 cr10000SHGC-2576
Homo sapiensradiation hybridGeneMap99-G314274 cr10000SHGC-2470
Homo sapienslinkageRutgers Map14 cmHUM00D0F11
Homo sapiensradiation hybridNCBI RH1430 crSHGC-2576

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID70226
Probe Cross-refcontext specific help for: Probe Cross-refGDB:214168; GDB:223606
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk