Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012816584

Eukaryota (5 taxa) STS probe D11S4578 for DCN1, defective in cullin neddylation 1, domain containing 5 (DCUN1D5) and 4 more genes

Synopsis

Field NameValues
NameD11S4578
AliasesRH35152; SHGC-8453
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesDCUN1D5 (Pongo abelii); DCUN1D5 (Nomascus leucogenys); DCUN1D5 (Pan troglodytes); DCUN1D5 (Macaca mulatta); DCUN1D5 (Homo sapiens)

Sequences

>Probe|12816584|PRIMERF Forward PCR primer (outermost) (21b)
TGACAGAGCCAAGTAGGCAGT
>Probe|12816584|PRIMERR Reverse PCR primer (outermost) (21b)
CAATGGAAAAAGACCACCAGA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3114523 cr10000SHGC-8453
Homo sapienslinkageRutgers Map11 cmD11S4578
Homo sapiensradiation hybridNCBI RH11897.6 crSHGC-8453

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID69906
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740228
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk