Display Settings:

Format

Send to:

Choose Destination
Pr012815883

STS probe G29214 for suppressor of Ty 16 homolog (S. cerevisiae) (SUPT16H) and 8 more genes

Synopsis

Field NameValues
NameG29214
AliasesSHGC-16495
TypeSTS
Application
Source organism
Source sequence
Target genesSUPT16H; RPGRIP1; SUPT16H; RPGRIP1; SUPT16H; RPGRIP1; SUPT16H; RPGRIP1; LOC740638
UniSTS IDUniSTS:6927

Sequences

>Probe|12815883|PRIMERF Forward PCR primer (outermost) (22b)
ACAAACAAACATAAAATCCGGG
>Probe|12815883|PRIMERR Reverse PCR primer (outermost) (23b)
GTATTTGGGGAGTTTATCTTGCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID6927
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk