Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012815496

Eukaryota (5 taxa) STS probe RH11519 for calmodulin 3 (phosphorylase kinase, delta) (CALM3) and 7 more genes

Synopsis

Field NameValues
NameRH11519
AliasesRH128; stSG360
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100287237 (Homo sapiens); LOC100293219 (Homo sapiens); LOC100445419 (Pongo abelii); CALM3 (Nomascus leucogenys); CALM3 (Pan troglodytes); LOC716584 (Macaca mulatta); LOC746244 (Pan troglodytes); CALM3 (Homo sapiens)

Sequences

>Probe|12815496|PRIMERF Forward PCR primer (outermost) (20b)
TCTTCTCATCCACCCTCTGG
>Probe|12815496|PRIMERR Reverse PCR primer (outermost) (20b)
ATTCCGAAAATGTCCACAGC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB419254.26 cr3000stSG360
Homo sapienslinkageRutgers Map19 cmRH11519
Homo sapiensradiation hybridNCBI RH19516.7 crstSG360

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID68920
Probe Cross-refcontext specific help for: Probe Cross-refGDB:628174
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk