Display Settings:

Format

Send to:

Choose Destination
Pr012815441

STS probe D14S973 for Ras and Rab interactor 3 (RIN3) and 2 more genes

Synopsis

Field NameValues
NameD14S973
AliasesA112XC1; AFMA112XC1; AFMa112xc1; HSA112XC1; W5375
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100414796; RIN3; RIN3
UniSTS IDUniSTS:68870

Sequences

>Probe|12815441|PRIMERF Forward PCR primer (outermost) (19b)
TCTTCCAAACCAGCAAAGG
>Probe|12815441|PRIMERR Reverse PCR primer (outermost) (22b)
GGTCTCTGGACCACTGAGAAAC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmD14S973
Homo sapienslinkageMarshfield14107.13 cmAFMa112xc1
Homo sapienslinkageGenethon1497.7 cmAFMa112xc1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID68870
Probe Cross-refcontext specific help for: Probe Cross-refGDB:602990
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk