Display Settings:

Format

Send to:

Choose Destination
Pr012814453

STS probe AL008908 for 5-hydroxytryptamine receptor 2C (HTR2C) and 2 more genes

Synopsis

Field NameValues
NameAL008908
AliasesDJ435I6T7; stSG20795
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesHTR2C; HTR2C; HTR2C
UniSTS IDUniSTS:6797

Sequences

>Probe|12814453|PRIMERF Forward PCR primer (outermost) (20b)
AATTTGCCAGATGGTTTTGC
>Probe|12814453|PRIMERR Reverse PCR primer (outermost) (18b)
GACCTCCAACCATCGTGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL008908

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID6797
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk