Display Settings:

Format

Send to:

Choose Destination
Pr012814221

STS probe D20S898 for MACRO domain containing 2 (MACROD2) and 4 more genes

Synopsis

Field NameValues
NameD20S898
AliasesAFMC013XE5; AFMc013xe5; C013XE5; HSC013XE5; RH31470; SHGC-21122; W6999
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMACROD2; MACROD2; MACROD2; MACROD2; MACROD2
UniSTS IDUniSTS:67758

Sequences

>Probe|12814221|PRIMERF Forward PCR primer (outermost) (25b)
TCTATGCAATACTTATCAATGTCTG
>Probe|12814221|PRIMERR Reverse PCR primer (outermost) (25b)
TATTAGGACTCCACAATTATGTCTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 4 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G320765 cr10000SHGC-21122
Homo sapiensradiation hybridGeneMap99-G320798 cr10000AFMc013xe5
Homo sapienslinkageRutgers Map20 cmD20S898
Homo sapienslinkageMarshfield2035.51 cmAFMc013xe5
Homo sapienslinkageGenethon2035.8 cmAFMc013xe5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID67758
Probe Cross-refcontext specific help for: Probe Cross-refGDB:612312
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk