Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012814088

Eukaryota (4 taxa) STS probe SHGC-12725 for arachidonate 12-lipoxygenase (ALOX12) and 5 more genes

Synopsis

Field NameValues
NameSHGC-12725
AliasesRH14034; WI-7658
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesALOX12 (Pongo abelii); LOC100506713 (Homo sapiens); LOC100510356 (Homo sapiens); ALOX12 (Nomascus leucogenys); ALOX12 (Homo sapiens); ALOX12 (Pan troglodytes)

Sequences

>Probe|12814088|PRIMERF Forward PCR primer (outermost) (23b)
TCTACCTGCAAGATTTCACATCA
>Probe|12814088|PRIMERR Reverse PCR primer (outermost) (24b)
TGGAACATAGTCACACTCATTTCC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G317422 cr10000SHGC-12725
Homo sapiensradiation hybridGeneMap99-G317422 cr10000SHGC-12725
Homo sapienslinkageRutgers Map17 cmSHGC-12725
Homo sapiensradiation hybridNCBI RH17175.9 crSHGC-12725

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID67637
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Write to the Help Desk