Display Settings:

Format

Send to:

Choose Destination
Pr012813123

STS probe DXS7611 for upstream binding transcription factor, RNA polymerase I pseudogene (LOC442446) and 2 more genes

Synopsis

Field NameValues
NameDXS7611
AliasesHUMSWX1200; sWXD1200
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100435753; LOC100584510; LOC442446
UniSTS IDUniSTS:66764

Sequences

>Probe|12813123|PRIMERF Forward PCR primer (outermost) (19b)
TCCGTATGTGACTTGGTAG
>Probe|12813123|PRIMERR Reverse PCR primer (outermost) (22b)
GCCACAATGCTTGGAAAATTAC

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS7611
Homo sapiensphysicalWUSTL-XX0.55 ordinalsWXD1200

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID66764
Probe Cross-refcontext specific help for: Probe Cross-refGDB:600106
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk