Display Settings:

Format

Send to:

Choose Destination
Pr012812714

Eukaryota (4 taxa) STS probe D22S1247 for guanylyl cyclase domain containing 1 (GUCD1) and 3 more genes

Synopsis

Field NameValues
NameD22S1247
AliasesRH1923; SHGC-11564
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesGUCD1 (Pongo abelii); GUCD1 (Nomascus leucogenys); GUCD1 (Pan troglodytes); GUCD1 (Homo sapiens)
UniSTS IDUniSTS:66393

Sequences

>Probe|12812714|PRIMERF Forward PCR primer (outermost) (18b)
TCCCACATGGCTTCAGGT
>Probe|12812714|PRIMERR Reverse PCR primer (outermost) (23b)
TTCTCAAGACTCATCTGCCTAGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G322388 cr10000SHGC-11564
Homo sapiensradiation hybridGeneMap99-G322388 cr10000SHGC-11564
Homo sapienslinkageRutgers Map22 cmD22S1247
Homo sapiensradiation hybridNCBI RH2288.6 crSHGC-11564

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID66393
Probe Cross-refcontext specific help for: Probe Cross-refGDB:676390; GDB:676900
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk