Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012811911

Eukaryota (11 taxa) STS probe STS-AA035142 for hepatoma-derived growth factor, related protein 3 (HDGFRP3) and 13 more genes

Synopsis

Field NameValues
NameSTS-AA035142
AliasesRH76090; sts-AA035142
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Canis lupus familiaris; Ailuropoda melanoleuca; Sus scrofa; Bos taurus; Oryctolagus cuniculus
Target genesLOC100154801 (Sus scrofa); LOC100342930 (Oryctolagus cuniculus); HDGFRP3 (Callithrix jacchus); LOC100430531 (Macaca mulatta); LOC100450041 (Pongo abelii); LOC100464120 (Ailuropoda melanoleuca); LOC100603999 (Nomascus leucogenys); TM6SF1 (Pan troglodytes); HDGFRP3 (Canis lupus familiaris); HDGFRP3 (Homo sapiens); LOC530971 (Bos taurus); TM6SF1 (Bos taurus); HDGFRP3 (Pan troglodytes); HDGFRP3 (Bos taurus)

Sequences

>Probe|12811911|PRIMERF Forward PCR primer (outermost) (25b)
TCATTGCCTTTATTTTGGAGTAACA
>Probe|12811911|PRIMERR Reverse PCR primer (outermost) (20b)
GTCCTTCAGTTTTGAGGCCA

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415288.96 cr3000sts-AA035142
Homo sapienslinkageRutgers Map15 cmSTS-AA035142
Homo sapiensradiation hybridNCBI RH15558 crsts-AA035142

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID65668
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk