Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012811756

Eukaryota (5 taxa) STS probe SHGC-36068 for cholinergic receptor, nicotinic, alpha 7 (neuronal) (CHRNA7) and 5 more genes

Synopsis

Field NameValues
NameSHGC-36068
AliasesRH33698; WIAF-3980
TypeSTS
Application
Source organism
Source sequence
Target organismsCallithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100385253 (Callithrix jacchus); CHRNA7 (Pongo abelii); CHRNA7 (Homo sapiens); CHRNA7 (Pan troglodytes); CHRNA7 (Macaca mulatta); CHRFAM7A (Homo sapiens)

Sequences

>Probe|12811756|PRIMERF Forward PCR primer (outermost) (25b)
TCATGCATTTTAAGTACATGATTCA
>Probe|12811756|PRIMERR Reverse PCR primer (outermost) (19b)
TTTGTGGGGTGATGGGAAT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G315346 cr10000SHGC-36068
Homo sapiensradiation hybridGeneMap99-G315346 cr10000SHGC-36068
Homo sapiensradiation hybridNCBI RH1546.8 crSHGC-36068

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID65528
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk