Display Settings:

Format

Send to:

Choose Destination
Pr012810674

Homo sapiens STS probe AL009771

Synopsis

Field NameValues
NameAL009771
AliasstSG32674FS
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:64549

Sequences

>Probe|12810674|PRIMERF Forward PCR primer (outermost) (22b)
TCACCATTATGTTAACCGTGTG
>Probe|12810674|PRIMERR Reverse PCR primer (outermost) (22b)
TGCTCCAACACATAAAAATCAA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmAL009771

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID64549
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk