Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012810444

Eukaryota (5 taxa) STS probe RH70446 for vesicle amine transport 1-like (VAT1L) and 4 more genes

Synopsis

Field NameValues
NameRH70446
AliasesT92729
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesKIAA1576 (Pongo abelii); VAT1L (Callithrix jacchus); VAT1L (Nomascus leucogenys); VAT1L (Homo sapiens); VAT1L (Pan troglodytes)

Sequences

>Probe|12810444|PRIMERF Forward PCR primer (outermost) (25b)
AATTACTCTTTGGATGGCTTTGTCT
>Probe|12810444|PRIMERR Reverse PCR primer (outermost) (20b)
TGTTACCACAGTCCCTGGAT

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB416455.13 cr3000T92729
Homo sapienslinkageRutgers Map16 cmRH70446

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID6434
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk