Display Settings:

Format

Send to:

Choose Destination
Pr012810287

STS probe D6S1550 for parkin RBR E3 ubiquitin protein ligase (PARK2) and 3 more genes

Synopsis

Field NameValues
NameD6S1550
AliasesA141ZD9; AFMa141zd9; HSA141ZD9; RH37602; W3014; stSG14613
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPARK2; PARK2; PARK2; PARK2
UniSTS IDUniSTS:64198

Sequences

>Probe|12810287|PRIMERF Forward PCR primer (outermost) (22b)
TCAAGGGTACAATTCTCAAGTC
>Probe|12810287|PRIMERR Reverse PCR primer (outermost) (22b)
TTGTGGTGCAAAGTATTCAGTC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmD6S1550
Homo sapienslinkageMarshfield6166.39 cmAFMa141zd9
Homo sapienslinkageGenethon6166.6 cmAFMa141zd9

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID64198
Probe Cross-refcontext specific help for: Probe Cross-refGDB:603548
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk