Display Settings:

Format

Send to:

Choose Destination
Pr012810060

Eukaryota (4 taxa) STS probe D12S1844 for solute carrier family 41 (magnesium transporter), member 2 (SLC41A2) and 3 more genes

Synopsis

Field NameValues
NameD12S1844
AliasesRH29316; SHGC-12240
TypeSTS
Application
Source organism
Source sequence
Target organismsCallithrix jacchus; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesSLC41A2 (Callithrix jacchus); SLC41A2 (Pongo abelii); SLC41A2 (Pan troglodytes); SLC41A2 (Homo sapiens)
UniSTS IDUniSTS:63993

Sequences

>Probe|12810060|PRIMERF Forward PCR primer (outermost) (25b)
TCAAATAATCCATGAAGCTAAGAGG
>Probe|12810060|PRIMERR Reverse PCR primer (outermost) (20b)
ATGCATTCTTCAATCCCAGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3124347 cr10000SHGC-12240
Homo sapienslinkageRutgers Map12 cmD12S1844

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID63993
Probe Cross-refcontext specific help for: Probe Cross-refGDB:638311
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk