Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012809887

Pan troglodytes and Homo sapiens STS probe SHGC-60027 for enolase superfamily member 1 (ENOSF1) and 1 more gene

Synopsis

Field NameValues
NameSHGC-60027
AliasesRH43927; RH99915
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Homo sapiens
Target genesENOSF1 (Homo sapiens); ENOSF1 (Pan troglodytes)

Sequences

>Probe|12809887|PRIMERF Forward PCR primer (outermost) (25b)
TATTTTTGTAAGAACATCCTCCTGG
>Probe|12809887|PRIMERR Reverse PCR primer (outermost) (25b)
AAAATGGATTTAAAAAATCCTACCG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map18 cmSHGC-60027

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID63835
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk