Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012809699

Eukaryota (6 taxa) STS probe SHGC-35969 for hepatoma-derived growth factor, related protein 3 (HDGFRP3) and 7 more genes

Synopsis

Field NameValues
NameSHGC-35969
AliasesRH37831
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesTM6SF1 (Pongo abelii); HDGFRP3 (Callithrix jacchus); LOC100430531 (Macaca mulatta); LOC100450041 (Pongo abelii); LOC100603999 (Nomascus leucogenys); TM6SF1 (Pan troglodytes); HDGFRP3 (Homo sapiens); HDGFRP3 (Pan troglodytes)

Sequences

>Probe|12809699|PRIMERF Forward PCR primer (outermost) (22b)
TATTGTCAGCTTGCTGTGAACA
>Probe|12809699|PRIMERR Reverse PCR primer (outermost) (24b)
TACTGGGAGTAAGATTTGAGGTTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3152976 cr10000SHGC-35969
Homo sapiensradiation hybridGeneMap99-G3152971 cr10000SHGC-35969
Homo sapienslinkageRutgers Map15 cmSHGC-35969
Homo sapiensradiation hybridNCBI RH15578.5 crSHGC-35969

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID63665
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk