Display Settings:

Format

Send to:

Choose Destination
Pr012809533

STS probe SHGC-36542 for chromosome 9 open reading frame 72 (C9orf72) and 5 more genes

Synopsis

Field NameValues
NameSHGC-36542
AliasRH38026
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesC9H9orf72; C8H9orf72; HOOK3; C9orf72; C9H9orf72; C15H9orf72
UniSTS IDUniSTS:63515

Sequences

>Probe|12809533|PRIMERF Forward PCR primer (outermost) (25b)
TATTCAAAATTCTCCATTTAGGAGA
>Probe|12809533|PRIMERR Reverse PCR primer (outermost) (22b)
ACTGGTTATTTTCTTTGGCTGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G391105 cr10000SHGC-36542
Homo sapiensradiation hybridGeneMap99-G391152 cr10000SHGC-36542
Homo sapienslinkageRutgers Map9 cmSHGC-36542
Homo sapiensradiation hybridNCBI RH9313.5 crSHGC-36542

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID63515
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk