Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012809282

Pan troglodytes and Homo sapiens STS probe D20S1020 for teashirt zinc finger homeobox 2 (TSHZ2) and 1 more gene

Synopsis

Field NameValues
NameD20S1020
AliasesMR14982; RH5160; RH57474; WI-10832; WIAF-756
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Homo sapiens
Target genesTSHZ2 (Homo sapiens); TSHZ2 (Pan troglodytes)

Sequences

>Probe|12809282|PRIMERF Forward PCR primer (outermost) (18b)
TATGCCTTCCCAACGAGC
>Probe|12809282|PRIMERR Reverse PCR primer (outermost) (22b)
CCGAACTAGTATTTCACGGAGC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map20 cmD20S1020
Homo sapiensradiation hybridNCBI RH20535.6 crWI-10832
Homo sapiensradiation hybridWhitehead-RH20334.6 cr3000WI-10832

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID63286
Probe Cross-refcontext specific help for: Probe Cross-refGDB:677910
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk