Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012808890

Homo sapiens STS probe D13S1811 for glypican 5 (GPC5)

Synopsis

Field NameValues
NameD13S1811
AliasesCHLC.GATA21B04; CHLC.GATA21B04.P8879; D13S785; GATA-D13S785; GATA21B04; RH30193; RH3543; RH53415; SHGC-17583
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneGPC5 (Homo sapiens)

Sequences

>Probe|12808890|PRIMERF Forward PCR primer (outermost) (22b)
TATAGGATCTGGAGTCTGCTCC
>Probe|12808890|PRIMERR Reverse PCR primer (outermost) (22b)
CCTTTTCCTTCACACTTAGACG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 4 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

4.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3132649 cr10000SHGC-17583
Homo sapienslinkageMarshfield1372.05 cmGATA21B04
Homo sapiensradiation hybridNCBI RH13859 crSHGC-17583
Homo sapiensradiation hybridWhitehead-RH13249.9 cr3000CHLC.GATA21B04

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:1298560; GDB:365126
UniSTS IDcontext specific help for: UniSTS ID62926
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk