Display Settings:

Format

Send to:

Choose Destination
Pr012807752

Homo sapiens STS probe D10S1435

Synopsis

Field NameValues
NameD10S1435
AliasesCHLC.GATA88F09; CHLC.GATA88F09.P19317; GATA-P19317; GATA88F09; RH2639; RH28132; RH30121; RH50912; SHGC-17481
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:61895

Sequences

>Probe|12807752|PRIMERF Forward PCR primer (outermost) (20b)
TACTTGGGATGCTAAGGTGG
>Probe|12807752|PRIMERR Reverse PCR primer (outermost) (20b)
TTGGGTTTCCTGACTTGTGT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Show All 3 References...

3.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G31081 cr10000SHGC-17481
Homo sapienslinkageRutgers Map10 cmD10S1435
Homo sapiensradiation hybridNCBI RH1060.2 crSHGC-17481
Homo sapiensradiation hybridWhitehead-RH1034.5 cr3000CHLC.GATA88F09

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID61895
Probe Cross-refcontext specific help for: Probe Cross-refGDB:456036
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk