Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012807654

Eukaryota (5 taxa) STS probe SHGC-33472 for GATA binding protein 4 (GATA4) and 9 more genes

Synopsis

Field NameValues
NameSHGC-33472
AliasesRH32797
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100427584 (Macaca mulatta); LOC100441566 (Pongo abelii); GATA4 (Pongo abelii); GATA4 (Nomascus leucogenys); LOC100602435 (Nomascus leucogenys); GATA4 (Homo sapiens); GATA4 (Pan troglodytes); C8orf49 (Homo sapiens); GATA4 (Macaca mulatta); LOC740630 (Pan troglodytes)

Sequences

>Probe|12807654|PRIMERF Forward PCR primer (outermost) (22b)
TACTGATTTTCCAGCCATTTCA
>Probe|12807654|PRIMERR Reverse PCR primer (outermost) (23b)
ACCTTTGAACCAAGATTCTGTTT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G38254 cr10000SHGC-33472
Homo sapiensradiation hybridGeneMap99-G38241 cr10000SHGC-33472

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID61804
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk