Display Settings:

Format

Send to:

Choose Destination
Pr012807514

STS probe D16S2625 for lin-54 DREAM MuvB core complex component (Lin54)

Synopsis

Field NameValues
NameD16S2625
AliasesCHLC.GATA86C08; CHLC.GATA86C08.P19292; GATA-P19292; GATA86C08; RH30229; RH4023; RH54500; RH85411; SHGC-17629
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLin54
UniSTS IDUniSTS:61678

Sequences

>Probe|12807514|PRIMERF Forward PCR primer (outermost) (20b)
TACGCAAGTCAAAGAGCCTC
>Probe|12807514|PRIMERR Reverse PCR primer (outermost) (20b)
GGACACATGAGACCCTGTCT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 4 References...

3.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

4.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3163247 cr10000SHGC-17629
Homo sapienslinkageRutgers Map16 cmD16S2625
Homo sapienslinkageMarshfield16120.59 cmGATA86C08
Homo sapienslinkagedeCODE16116.89 cmD16S2625
Homo sapiensradiation hybridWhitehead-RH16331.5 cr3000CHLC.GATA86C08

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID61678
Probe Cross-refcontext specific help for: Probe Cross-refGDB:456014; RGD:5505494
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk