Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012806108

Eukaryota (3 taxa) STS probe D3S1280 for muscleblind-like splicing regulator 1 (MBNL1) and 2 more genes

Synopsis

Field NameValues
NameD3S1280
AliasesAFM177xe9; RH1061; RH13308; SHGC-822; stSG633
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Pan troglodytes; Homo sapiens
Target genesMBNL1 (Homo sapiens); MBNL1 (Pan troglodytes); MBNL1 (Macaca mulatta)

Sequences

>Probe|12806108|PRIMERF Forward PCR primer (outermost) (20b)
TAACAATGCCTTCTTCTGGA
>Probe|12806108|PRIMERR Reverse PCR primer (outermost) (20b)
GCCTAAGTCACCAGAGGACT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 4 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

4.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G336892 cr10000SHGC-822
Homo sapiensradiation hybridGeneMap99-G337362 cr10000AFM177xe9
Homo sapiensradiation hybridGeneMap99-GB43565.82 cr3000AFM177xe9
Homo sapiensradiation hybridNCBI RH31328.6 crSHGC-822

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID60400
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk