Display Settings:

Format

Send to:

Choose Destination
Pr012805718

Eukaryota (8 taxa) STS probe D2S2560 for annexin A4 (ANXA4) and 7 more genes

Synopsis

Field NameValues
NameD2S2560
AliasesRH82254; RH8731; SHGC-9858
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Equus caballus; Bos taurus
Target genesANXA4 (Equus caballus); ANXA4 (Callithrix jacchus); ANXA4 (Pongo abelii); ANXA4 (Nomascus leucogenys); ANXA4 (Bos taurus); ANXA4 (Homo sapiens); ANXA4 (Pan troglodytes); ANXA4 (Macaca mulatta)
UniSTS IDUniSTS:60046

Sequences

>Probe|12805718|PRIMERF Forward PCR primer (outermost) (20b)
TAAAACGCCTACAGCTGCCT
>Probe|12805718|PRIMERR Reverse PCR primer (outermost) (24b)
TAAGCTTTGAAATGCAAGTACAGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G323021 cr10000SHGC-9858
Homo sapiensradiation hybridGeneMap99-G322932 cr10000SHGC-9858
Homo sapiensradiation hybridTNG244565 cr50000SHGC-9858
Homo sapienslinkageRutgers Map2 cmD2S2560

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID60046
Probe Cross-refcontext specific help for: Probe Cross-refGDB:674993; GDB:675617
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk