Display Settings:

Format

Send to:

Choose Destination
Pr012805383

Homo sapiens STS probe D10S1784

Synopsis

Field NameValues
NameD10S1784
AliasesA064WB1; AFMA064WB1; AFMa064wb1; HSA064WB1; W5150
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:59745

Sequences

>Probe|12805383|PRIMERF Forward PCR primer (outermost) (20b)
GTTTGAATTTTTCACTCTGG
>Probe|12805383|PRIMERR Reverse PCR primer (outermost) (16b)
TTATGGGAGACAGGGC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map10 cmD10S1784
Homo sapienslinkageMarshfield1072.9 cmAFMa064wb1
Homo sapienslinkageGenethon1075.4 cmAFMa064wb1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID59745
Probe Cross-refcontext specific help for: Probe Cross-refGDB:614184
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk