Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012804931

Eukaryota (3 taxa) STS probe D4S477 for glutamate receptor, ionotropic, delta 2 (GRID2) and 2 more genes

Synopsis

Field NameValues
NameD4S477
AliasesHUM4STS406; RH28901; SHGC4-406
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Homo sapiens
Target genesGRID2 (Nomascus leucogenys); GRID2 (Homo sapiens); GRID2 (Pan troglodytes)

Sequences

>Probe|12804931|PRIMERF Forward PCR primer (outermost) (25b)
GTTGCAAACAACCAACTTATATCCT
>Probe|12804931|PRIMERR Reverse PCR primer (outermost) (23b)
CAGAGATGCCAGATACTAAGAGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G345376 cr10000SHGC4-406
Homo sapienslinkageRutgers Map4 cmD4S477
Homo sapiensradiation hybridNCBI RH41076.9 crSHGC4-406

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID59336
Probe Cross-refcontext specific help for: Probe Cross-refGDB:189592
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Write to the Help Desk