Display Settings:

Format

Send to:

Choose Destination
Pr012804220

Eukaryota (4 taxa) STS probe D5S2897 for catenin (cadherin-associated protein), delta 2 (CTNND2) and 3 more genes

Synopsis

Field NameValues
NameD5S2897
Aliases63e792
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesCTNND2 (Pongo abelii); CTNND2 (Homo sapiens); CTNND2 (Pan troglodytes); LOC716900 (Macaca mulatta)
UniSTS IDUniSTS:58697

Sequences

>Probe|12804220|PRIMERF Forward PCR primer (outermost) (21b)
GTGTGCTGAAAGTATGAAAGG
>Probe|12804220|PRIMERR Reverse PCR primer (outermost) (20b)
TGGCCTCCCTTCTCTCAAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmD5S2897

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID58697
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk