Display Settings:

Format

Send to:

Choose Destination
Pr012803546

STS probe 1376 for lysine (K)-specific demethylase 6A (KDM6A) and 4 more genes

Synopsis

Field NameValues
Name1376
Aliases1375; DXS7438E; RH28496
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesKDM6A; KDM6A; KDM6A; KDM6A; KDM6A
UniSTS IDUniSTS:58087

Sequences

>Probe|12803546|PRIMERF Forward PCR primer (outermost) (20b)
GTGCCTTAGAGATCATCTAG
>Probe|12803546|PRIMERR Reverse PCR primer (outermost) (20b)
CTTGGAGTTGTTTGCTCAAT

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB4X115.78 cr30001375
Homo sapienslinkageRutgers MapX cm1376
Homo sapiensradiation hybridNCBI RHX153.7 cr1375

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID58087
Probe Cross-refcontext specific help for: Probe Cross-refGDB:581534
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk