Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012803477

Eukaryota (8 taxa) STS probe A006N06 for solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 (SLC25A4) and 7 more genes

Synopsis

Field NameValues
NameA006N06
AliasesRH25847
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Canis lupus familiaris; Sus scrofa; Bos taurus
Target genesSLC25A4 (Pongo abelii); SLC25A4 (Sus scrofa); SLC25A4 (Nomascus leucogenys); SLC25A4 (Bos taurus); SLC25A4 (Homo sapiens); SLC25A4 (Pan troglodytes); SLC25A4 (Canis lupus familiaris); SLC25A4 (Macaca mulatta)

Sequences

>Probe|12803477|PRIMERF Forward PCR primer (outermost) (21b)
GTGCATTAAGTGGTCTTTATT
>Probe|12803477|PRIMERR Reverse PCR primer (outermost) (23b)
TGTGGTTTAATAGACTATTCCTA

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB44683.47 cr3000A006N06
Homo sapienslinkageRutgers Map4 cmA006N06
Homo sapiensradiation hybridNCBI RH41723.8 crA006N06

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID58023
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk