Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012803024

Homo sapiens STS probe D12S2093

Synopsis

Field NameValues
NameD12S2093
AliasesRH34462; SHGC-5883
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens

Sequences

>Probe|12803024|PRIMERF Forward PCR primer (outermost) (20b)
GTGAAACTCCGTCTGAAAAA
>Probe|12803024|PRIMERR Reverse PCR primer (outermost) (20b)
CAGAATGTCAGGAATTTCCA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3122755 cr10000SHGC-5883
Homo sapienslinkageRutgers Map12 cmD12S2093
Homo sapiensradiation hybridNCBI RH12520.6 crSHGC-5883

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID57612
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740717
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk