Display Settings:

Format

Send to:

Choose Destination
Pr012801332

STS probe STS-M78304 for transcription factor 12 (TCF12) and 3 more genes

Synopsis

Field NameValues
NameSTS-M78304
AliasesD15S142E; M78304; RH36930; sts-M78304
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTCF12; TCF12; TCF12; TCF12
UniSTS IDUniSTS:56079

Sequences

>Probe|12801332|PRIMERF Forward PCR primer (outermost) (20b)
GTAAGCTTCTCATTAACTGA
>Probe|12801332|PRIMERR Reverse PCR primer (outermost) (20b)
TAAGCCATATGAGGATTGAG

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415202.66 cr3000sts-M78304
Homo sapienslinkageRutgers Map15 cmSTS-M78304

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID56079
Probe Cross-refcontext specific help for: Probe Cross-refGDB:189055
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk