Display Settings:

Format

Send to:

Choose Destination
Pr012801215

STS probe Bdaa6a02 for eukaryotic translation initiation factor 3, subunit J (EIF3J) and 6 more genes

Synopsis

Field NameValues
NameBdaa6a02
AliasesD15S691E; RH10803
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEIF3J; LOC100437269; EIF3J; LOC453711; EIF3J; EIF3J; EIF3J
UniSTS IDUniSTS:55973

Sequences

>Probe|12801215|PRIMERF Forward PCR primer (outermost) (22b)
GTAAAGTTGTTCCATTGCAGCC
>Probe|12801215|PRIMERR Reverse PCR primer (outermost) (18b)
GAACTGCTTCAGGTGGGG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415152.94 cr3000Bdaa6a02
Homo sapiensradiation hybridNCBI RH15169.1 crBdaa6a02

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:446868
UniSTS IDcontext specific help for: UniSTS ID55973
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk