Display Settings:

Format

Send to:

Choose Destination
Pr012799465

STS probe DXYS131 for short stature homeobox (SHOX)

Synopsis

Field NameValues
NameDXYS131
AliasesSHGC-5421
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneSHOX
UniSTS IDUniSTS:54705

Sequences

>Probe|12799465|PRIMERF Forward PCR primer (outermost) (20b)
GGGTGCATTGTGATTCCAAG
>Probe|12799465|PRIMERR Reverse PCR primer (outermost) (20b)
TCAGTGCATCGTGCAGTGAC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3Y38 cr10000SHGC-5421

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:191388
UniSTS IDcontext specific help for: UniSTS ID54705
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk