Display Settings:

Format

Send to:

Choose Destination
Pr012799097

STS probe Crx

Synopsis

Field NameValues
NameCrx
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:546710

Sequences

>Probe|12799097|PRIMERF Forward PCR primer (outermost) (21b)
ATGATGGCATATATGAACCCG
>Probe|12799097|PRIMERR Reverse PCR primer (outermost) (21b)
CTACAAGATCTGAAACTTCCA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:5307512
UniSTS IDcontext specific help for: UniSTS ID546710
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk