Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012795946

Eukaryota (6 taxa) STS probe SHGC-35771 for glucosamine (N-acetyl)-6-sulfatase (GNS) and 5 more genes

Synopsis

Field NameValues
NameSHGC-35771
AliasesRH37782; WIAF-4068
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Equus caballus
Target genesG6S (Equus caballus); GNS (Pongo abelii); GNS (Nomascus leucogenys); GNS (Homo sapiens); GNS (Pan troglodytes); GNS (Macaca mulatta)

Sequences

>Probe|12795946|PRIMERF Forward PCR primer (outermost) (20b)
GGGGCCACAGTTCTTGATTA
>Probe|12795946|PRIMERR Reverse PCR primer (outermost) (24b)
AGCTCTGATGGTTACTCTTCAAGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3122684 cr10000SHGC-35771
Homo sapiensradiation hybridGeneMap99-G3122630 cr10000SHGC-35771
Homo sapienslinkageRutgers Map12 cmSHGC-35771
Homo sapiensradiation hybridNCBI RH12506 crSHGC-35771

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID54374
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk