Display Settings:

Format

Send to:

Choose Destination
Pr012791084

Eukaryota (3 taxa) STS probe D8S2099 for methionine sulfoxide reductase A (MSRA) and 2 more genes

Synopsis

Field NameValues
NameD8S2099
AliasesRH29769; SHGC-14496
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Homo sapiens
Target genesMSRA (Nomascus leucogenys); MSRA (Homo sapiens); MSRA (Pan troglodytes)
UniSTS IDUniSTS:53936

Sequences

>Probe|12791084|PRIMERF Forward PCR primer (outermost) (18b)
GGGATGATGAAACGTGGG
>Probe|12791084|PRIMERR Reverse PCR primer (outermost) (25b)
TTCAGCTCTTTGACTATGTTATCCC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G38419 cr10000SHGC-14496
Homo sapienslinkageRutgers Map8 cmD8S2099
Homo sapiensradiation hybridNCBI RH885.6 crSHGC-14496

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID53936
Probe Cross-refcontext specific help for: Probe Cross-refGDB:739439
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk